dlc

Ensembl ID:
ENSDARG00000002336
ZFIN ID:
ZDB-GENE-000125-4
Description:
Delta-like protein C [Source:UniProtKB/Swiss-Prot;Acc:Q9IAT6]
Human Orthologue:
DLL3
Human Description:
delta-like 3 (Drosophila) [Source:HGNC Symbol;Acc:2909]
Mouse Orthologue:
Dll3
Mouse Description:
delta-like 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1096877]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35867 Nonsense Mutation detected in F1 DNA During 2017
sa42530 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35867
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018514 Nonsense 415 664 7 9

The following transcripts of ENSDARG00000002336 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 19427362)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20529988
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATTTGGGCAACAAAGCGACGTGCCGTTGCCGGCCCGGGTTCACAGGCT[C/A]ACGTTGTGAAACAAACATTGACGACTGCTCAAGCAACCCCTGTCAAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42530
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018514 Nonsense 548 664 7 9

The following transcripts of ENSDARG00000002336 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 19426964)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 20529590
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTCCTGCGACAGATGCGTCAGAACCACAAAGCCAGCTCAACCACAGTT[C/T]GAAACAACCTGGATTCTGTCAATAATCGCATTTCTTTGAGCCCAACCTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link