fam102bb

Ensembl ID:
ENSDARG00000002333
ZFIN ID:
ZDB-GENE-041014-330
Description:
hypothetical protein LOC557909 [Source:RefSeq peptide;Acc:NP_001038309]
Human Orthologue:
FAM102B
Human Description:
family with sequence similarity 102, member B [Source:HGNC Symbol;Acc:27637]
Mouse Orthologue:
Fam102b
Mouse Description:
family with sequence similarity 102, member B Gene [Source:MGI Symbol;Acc:MGI:3036259]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16607 Nonsense Available for shipment Available now
sa4107 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16607
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020183 Nonsense 121 367 4 11
Genomic Location:
Chromosome 20 (position 33796162)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTTTGCWGGATCGGGTAGCACCAYACGCAGGTGTCTGTTGGAGGGTTA[C/A]GACAYCAAAAACACTAGACAGGACAACTCCATCCTTAAGGTATGAAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4107
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020183 Essential Splice Site 150 367 5 11
Genomic Location:
Chromosome 20 (position 33792990)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTGATTATTAGCACACAGCTGATGTCCGGAGACCCCTGTTTCAAAACG[T/A]GAGTCTTACTCTTYATACCCGTCAATGTTAGAATTTGATTGCTGACACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t1nj1pr0