
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
fam102bb
- Ensembl ID:
- ENSDARG00000002333
- ZFIN ID:
- ZDB-GENE-041014-330
- Description:
- hypothetical protein LOC557909 [Source:RefSeq peptide;Acc:NP_001038309]
- Human Orthologue:
- FAM102B
- Human Description:
- family with sequence similarity 102, member B [Source:HGNC Symbol;Acc:27637]
- Mouse Orthologue:
- Fam102b
- Mouse Description:
- family with sequence similarity 102, member B Gene [Source:MGI Symbol;Acc:MGI:3036259]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43483 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa16607 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa43483
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000020183 | Essential Splice Site | 45 | 367 | 1 | 11 |
- Genomic Location (Zv9):
- Chromosome 20 (position 33814177)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 33886690 GRCz11 20 33789569 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTGTAAAGTCCGACTGCTCGACGGCGGATTCTCAGAAGAATCTTCGCGG[T/C]AAGAAACCTGTCAGATCTTCAGTGGATTAGTATGATTGGTTTAGATGAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16607
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000020183 | Nonsense | 121 | 367 | 4 | 11 |
- Genomic Location (Zv9):
- Chromosome 20 (position 33796162)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 33868675 GRCz11 20 33771554 - KASP Assay ID:
- 2261-4592.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAGTTTGCWGGATCGGGTAGCACCAYACGCAGGTGTCTGTTGGAGGGTTA[C/A]GACAYCAAAAACACTAGACAGGACAACTCCATCCTTAAGGTATGAAGACA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: