fam102bb

Ensembl ID:
ENSDARG00000002333
ZFIN ID:
ZDB-GENE-041014-330
Description:
hypothetical protein LOC557909 [Source:RefSeq peptide;Acc:NP_001038309]
Human Orthologue:
FAM102B
Human Description:
family with sequence similarity 102, member B [Source:HGNC Symbol;Acc:27637]
Mouse Orthologue:
Fam102b
Mouse Description:
family with sequence similarity 102, member B Gene [Source:MGI Symbol;Acc:MGI:3036259]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43483 Essential Splice Site Mutation detected in F1 DNA During 2016
sa16607 Nonsense Available for shipment Available now
sa4107 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa43483
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020183 Essential Splice Site 45 367 1 11
Genomic Location:
Chromosome 20 (position 33814177)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTAAAGTCCGACTGCTCGACGGCGGATTCTCAGAAGAATCTTCGCGG[T/C]AAGAAACCTGTCAGATCTTCAGTGGATTAGTATGATTGGTTTAGATGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16607
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020183 Nonsense 121 367 4 11
Genomic Location:
Chromosome 20 (position 33796162)
KASP Assay ID:
2261-4592.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTTTGCWGGATCGGGTAGCACCAYACGCAGGTGTCTGTTGGAGGGTTA[C/A]GACAYCAAAAACACTAGACAGGACAACTCCATCCTTAAGGTATGAAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4107
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020183 Essential Splice Site 150 367 5 11
Genomic Location:
Chromosome 20 (position 33792990)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTGATTATTAGCACACAGCTGATGTCCGGAGACCCCTGTTTCAAAACG[T/A]GAGTCTTACTCTTYATACCCGTCAATGTTAGAATTTGATTGCTGACACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link