frmd6

Ensembl ID:
ENSDARG00000002332
ZFIN ID:
ZDB-GENE-050522-354
Description:
Novel protein similar to H.sapiens FRMD6, FERM domain containing 6 (FRMD6, zgc:110114) [Source:UniPr
Human Orthologue:
FRMD6
Human Description:
FERM domain containing 6 [Source:HGNC Symbol;Acc:19839]
Mouse Orthologue:
Frmd6
Mouse Description:
FERM domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2442579]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2703 Essential Splice Site F2 line generated During 2014
sa9206 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2703
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024386 Essential Splice Site 116 616 5 14
ENSDART00000137328 None None 186 None 6
ENSDART00000138104 Essential Splice Site 116 616 4 13
Genomic Location:
Chromosome 13 (position 37378850)
KASP Assay ID:
554-3068.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTTCACTTCAGAGCACAGTATTATGTTGAAAATGGCAGACTTATYAG[G/A]TGAGACACATGCACATCAAAAGGAAAGACRCAATAAAASAATTAAAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9206
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024386 Nonsense 370 616 11 14
ENSDART00000137328 Nonsense 176 186 6 6
ENSDART00000138104 Nonsense 370 616 10 13
Genomic Location:
Chromosome 13 (position 37387547)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGGAGCAGCGTTCGCGTGCCAGCGGCAGCAGTGCGGGAAGCACATCA[C/T]GACCCAATCCCTTTTCACGGCACTCCACCACCAGTCATGGCAGCTCCCGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zpl0ssw4