lhx8a

Ensembl ID:
ENSDARG00000002330
ZFIN ID:
ZDB-GENE-031008-2
Description:
LIM/homeobox protein Lhx8 [Source:RefSeq peptide;Acc:NP_001003980]
Human Orthologue:
LHX8
Human Description:
LIM homeobox 8 [Source:HGNC Symbol;Acc:28838]
Mouse Orthologue:
Lhx8
Mouse Description:
LIM homeobox protein 8 Gene [Source:MGI Symbol;Acc:MGI:1096343]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18505 Nonsense Available for shipment Available now
sa18198 Nonsense Available for shipment Available now
sa180 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa18505
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019078 Nonsense 3 332 1 8
ENSDART00000144982 None None 237 None 6
ENSDART00000019078 Nonsense 3 332 1 8
ENSDART00000144982 None None 237 None 6

The following transcripts of ENSDARG00000002330 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 10997240)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTACAGGAGATCTGAGAGTGGATATWGCCTGTCATACTGGACAATGTACT[G/A]GAAAAATGAACAAACCACATCRAAAGAGAGCCCAAGCAAGAACACTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18198
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019078 Nonsense 3 332 1 8
ENSDART00000144982 None None 237 None 6
ENSDART00000019078 Nonsense 3 332 1 8
ENSDART00000144982 None None 237 None 6

The following transcripts of ENSDARG00000002330 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 10997240)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTACAGGAGATCTGAGAGTGGATATWGCCTGTCATACTGGACAATGTACT[G/A]GAAAAATGAACAAACCACATCRAAAGAGAGCCCAAGCAAGAACACTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa180
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019078 Nonsense 199 332 5 8
ENSDART00000144982 Nonsense 195 237 5 6

The following transcripts of ENSDARG00000002330 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 10999842)
KASP Assay ID:
554-0058.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTGAATGTGGAGGGAGCTGTTCCCTCAGAGCAGGAAGTAAATCAGCCT[A/T]AACCGGCCAAGAGGGCACGCACAAGTTTTACAGCTGACCAGWTACAGGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2fzznek6