me3

Ensembl ID:
ENSDARG00000002305
ZFIN ID:
ZDB-GENE-041111-294
Description:
NADP-dependent malic enzyme, mitochondrial [Source:RefSeq peptide;Acc:NP_001082825]
Human Orthologue:
ME3
Human Description:
malic enzyme 3, NADP(+)-dependent, mitochondrial [Source:HGNC Symbol;Acc:6985]
Mouse Orthologue:
Me3
Mouse Description:
malic enzyme 3, NADP(+)-dependent, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:1916679]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1196 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1196
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012385 Essential Splice Site 180 603 5 15
Genomic Location:
Chromosome 9 (position 35229363)
KASP Assay ID:
554-1105.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGGCATATYGCCACTATGCTGAACTCATGGCCAGAGGAGGAYATTAAGG[T/A]ATGTGCTAAAAGATAATGTTGTTATTTTGGTGCCAKCAAATGGGAGTTTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0nm12qg8