gins2

Ensembl ID:
ENSDARG00000002304
ZFIN ID:
ZDB-GENE-050419-19
Description:
DNA replication complex GINS protein PSF2 [Source:RefSeq peptide;Acc:NP_001019610]
Human Orthologue:
GINS2
Human Description:
GINS complex subunit 2 (Psf2 homolog) [Source:HGNC Symbol;Acc:24575]
Mouse Orthologue:
Gins2
Mouse Description:
GINS complex subunit 2 (Psf2 homolog) Gene [Source:MGI Symbol;Acc:MGI:1921019]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12139 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12139
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033746 Nonsense 48 182 2 5
Genomic Location:
Chromosome 18 (position 30436789)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATTTAGGCCCGTTCAACCCAGGTCTGCCTGTKGAAGTTCCTGTCTGGT[T/A]GGCCCTCAATCTKAAACAACGGCAGAAATGCAGGWTARTTCCTCCAGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gnkopy5e