p2rx2

Ensembl ID:
ENSDARG00000002300
ZFIN ID:
ZDB-GENE-030319-2
Description:
P2X purinoceptor 2 [Source:RefSeq peptide;Acc:NP_945334]
Human Orthologue:
P2RX2
Human Description:
purinergic receptor P2X, ligand-gated ion channel, 2 [Source:HGNC Symbol;Acc:15459]
Mouse Orthologue:
P2rx2
Mouse Description:
purinergic receptor P2X, ligand-gated ion channel, 2 Gene [Source:MGI Symbol;Acc:MGI:2665170]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33545 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33545
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019461 Essential Splice Site 248 400 8 12
Genomic Location (Zv9):
Chromosome 5 (position 14017311)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12314748
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTTTGATATGTAGGTTTAACATAAGTGTTAACATTTTACTACACATTC[A/G]GGGTGGAATAATTGGAGTGTTCATTAACTGGAAGTGCGATTTTGACGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link