si:dkey-21p1.3

Ensembl ID:
ENSDARG00000002295
ZFIN ID:
ZDB-GENE-081105-162
Description:
Novel collagen protein [Source:UniProtKB/TrEMBL;Acc:B0UYF9]
Human Orthologues:
COL24A1, COL27A1
Human Descriptions:
collagen, type XXIV, alpha 1 [Source:HGNC Symbol;Acc:20821]
collagen, type XXVII, alpha 1 [Source:HGNC Symbol;Acc:22986]
Mouse Orthologues:
Col24a1, Col27a1
Mouse Descriptions:
collagen, type XXIV, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1918605]
collagen, type XXVII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:2672118]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15248 Nonsense Available for shipment Available now
sa21230 Nonsense Available for shipment Available now
sa41153 Nonsense Mutation detected in F1 DNA During 2017
sa9363 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21231 Essential Splice Site Available for shipment Available now
sa640 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa15248
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098151   None 190 None 7
ENSDART00000125681   None 185 None 8
ENSDART00000128489 Nonsense 13 103 1 5
ENSDART00000129712   None 114 None 6
ENSDART00000134775 Nonsense 145 1125 9 52
Genomic Location (Zv9):
Chromosome 8 (position 15383158)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14828502
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATTAAATCTCTWCAGGGAAAACCAGGAGGTGATGGACCACCAGGTCAA[A/T]AAGGAGAGYGTGTATGTGCATCCAATATTATWTTCYGAAAACTTGTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21230
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098151   None 190 None 7
ENSDART00000125681   None 185 None 8
ENSDART00000128489 Nonsense 44 103 3 5
ENSDART00000129712   None 114 None 6
ENSDART00000134775 Nonsense 176 1125 11 52
Genomic Location (Zv9):
Chromosome 8 (position 15383480)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14828824
KASP Assay ID:
2260-0307.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCCACTTTTTTTTGTTTTAGGGTGCCATTGGAAAACCAGGAAATCTT[G/T]GACCCTCAGGTGATCCAGTAAGATTACCTCAAACAGCTCCTTAATATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41153
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098151 Nonsense 60 190 2 7
ENSDART00000125681   None 185 None 8
ENSDART00000128489   None 103 None 5
ENSDART00000129712   None 114 None 6
ENSDART00000134775 Nonsense 475 1125 26 52
Genomic Location (Zv9):
Chromosome 8 (position 15389051)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14834395
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTCAGGGTAAAGATGGACCTCTTGGACCCATCGGGCCTGAAGGAGAC[A/T]AAGGCAATAAAGTAGGCTGTATTTTTTTCTTTTCTTATCTTCATTTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9363
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098151 Essential Splice Site 154 190 None 7
ENSDART00000125681   None 185 None 8
ENSDART00000128489   None 103 None 5
ENSDART00000129712   None 114 None 6
ENSDART00000134775 Essential Splice Site 551 1125 None 52
Genomic Location (Zv9):
Chromosome 8 (position 15392453)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14837797
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTGCAYATTCTTGTTGNTTTTATGTTTTYTGTGGGTTTGTGAATATTT[A/C]GGGTCATCCAGGTGTAAGAGGTCAATCCGGATTAGTAGGACAGTACGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21231
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098151 Essential Splice Site 154 190 7 7
ENSDART00000125681   None 185 None 8
ENSDART00000128489   None 103 None 5
ENSDART00000129712   None 114 None 6
ENSDART00000134775 Essential Splice Site 551 1125 30 52
Genomic Location (Zv9):
Chromosome 8 (position 15392454)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14837798
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGCACATTCTTGTTGTTTTATGTTTTCTGTGGGTTTGTGAATATTTA[G/T]GGTCATCCAGGTGTAAGAGGTCAATCCGGATTAGTAGGACAGTACGGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa640
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098151   None 190 None 7
ENSDART00000125681   None 185 None 8
ENSDART00000128489   None 103 None 5
ENSDART00000129712   None 114 None 6
ENSDART00000134775 Nonsense 1087 1125 52 52
Genomic Location (Zv9):
Chromosome 8 (position 15400525)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14845869
KASP Assay ID:
554-0549.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTTGCATTATATTGCAGGTAACTGCACAGGTGAGGGTTCATGGGAGTT[C/A]AGAGCTCCACAGGGGAGACATGCAGCTACTTCCTATCAGAGATGTTTTTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link