si:ch211-197g15.9

Ensembl ID:
ENSDARG00000002293
ZFIN ID:
ZDB-GENE-050208-616
Description:
Novel protein containing a TLD domain [Source:UniProtKB/TrEMBL;Acc:Q1LVY5]
Human Orthologues:
IFI44, IFI44L
Human Descriptions:
interferon-induced protein 44 [Source:HGNC Symbol;Acc:16938]
interferon-induced protein 44-like [Source:HGNC Symbol;Acc:17817]
Mouse Orthologues:
H28, Ifi44
Mouse Descriptions:
histocompatibility 28 Gene [Source:MGI Symbol;Acc:MGI:95975]
interferon-induced protein 44 Gene [Source:MGI Symbol;Acc:MGI:2443016]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7251 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7251
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105455 Nonsense 431 479 8 8
Genomic Location (Zv9):
Chromosome 22 (position 17685109)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17436044
KASP Assay ID:
554-4719.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGCTGGTGTTGTGTGTGTGNNNNCAGGTGCAGGAGGTGAGCTCTCGGT[T/A]GGGTGTGCCGGTGTCTTGTGTTTTACCGGTGAAGAACTACAGTCAGGAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link