mcoln1

Ensembl ID:
ENSDARG00000002285
ZFIN ID:
ZDB-GENE-040426-2704
Description:
Mucolipin 1 [Source:UniProtKB/TrEMBL;Acc:A2BGV1]
Human Orthologue:
MCOLN1
Human Description:
mucolipin 1 [Source:HGNC Symbol;Acc:13356]
Mouse Orthologue:
Mcoln1
Mouse Description:
mucolipin 1 Gene [Source:MGI Symbol;Acc:MGI:1890498]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8964 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8964
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019646 Nonsense 440 581 11 16
ENSDART00000146101 Nonsense 440 581 11 15
Genomic Location:
Chromosome 1 (position 46163396)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGCTTTCCCTAACGTGATCCGGTTCTGTTGCTGTGTGGCGGTGATCTA[C/A]CTCGGTTATTGCTTCTGTGGCTGGATTGTGCTGGGACCATACCATGTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oxv0dqc0