dcaf13

Ensembl ID:
ENSDARG00000002267
ZFIN ID:
ZDB-GENE-040426-703
Description:
DDB1- and CUL4-associated factor 13 [Source:UniProtKB/Swiss-Prot;Acc:Q803X4]
Human Orthologue:
DCAF13
Human Description:
DDB1 and CUL4 associated factor 13 [Source:HGNC Symbol;Acc:24535]
Mouse Orthologue:
Dcaf13
Mouse Description:
DDB1 and CUL4 associated factor 13 Gene [Source:MGI Symbol;Acc:MGI:2684929]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25029 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25029
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015139 Essential Splice Site 417 445 10 11

The following transcripts of ENSDARG00000002267 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 47490924)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 44689120
KASP Assay ID:
554-7743.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGCAGAAGAGAGAGCTGAAGGAAATGAAGGAAGCACGCCGCAGGAAG[T/G]AAGTTCCCTTCAGAAAATGTTAATGTTTTTATAGTTTTCACAGTACTGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link