ca15c

Ensembl ID:
ENSDARG00000002259
ZFIN ID:
ZDB-GENE-061013-737
Description:
carbonic anhydrase XV c [Source:RefSeq peptide;Acc:NP_001070801]
Human Orthologue:
CA4
Human Description:
carbonic anhydrase IV [Source:HGNC Symbol;Acc:1375]
Mouse Orthologue:
Car4
Mouse Description:
carbonic anhydrase 4 Gene [Source:MGI Symbol;Acc:MGI:1096574]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11904 Nonsense Available for shipment Available now
sa41945 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa11904
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098039 Nonsense 55 262 4 9
ENSDART00000112433 Nonsense 48 324 3 8
Genomic Location (Zv9):
Chromosome 12 (position 5025713)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4308340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YTGAACTAGATTTTACCACMTGGCCTGAACTTGCTCCCCRTCACTGCAAT[G/T]GATCCAGCCARTCTCCTATTAAYATTGTCACAGCACAAGTTCAGGRAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41945
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098039 Nonsense 136 262 5 9
ENSDART00000112433 Nonsense 129 324 4 8
Genomic Location (Zv9):
Chromosome 12 (position 5023821)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4306448
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTAAAAATTTTCATCTTCACTGGGGCAGCGGCAGCTCCTTGCCTGGAT[C/A]AGAACACACTGTGAATGGCAAACAGTATGCAATGGAGGTATGAGTGGATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link