EPB41L3 (2 of 2)

Ensembl ID:
ENSDARG00000002255
Description:
erythrocyte membrane protein band 4.1-like 3 [Source:HGNC Symbol;Acc:3380]
Human Orthologue:
EPB41L3
Human Description:
erythrocyte membrane protein band 4.1-like 3 [Source:HGNC Symbol;Acc:3380]
Mouse Orthologue:
Epb4.1l3
Mouse Description:
erythrocyte protein band 4.1-like 3 Gene [Source:MGI Symbol;Acc:MGI:103008]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14659 Essential Splice Site Available for shipment Available now
sa44206 Nonsense Mutation detected in F1 DNA During 2016
sa44205 Nonsense Mutation detected in F1 DNA During 2016
sa37970 Nonsense Mutation detected in F1 DNA During 2016
sa25219 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14659
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022349 Essential Splice Site 142 821 8 26
ENSDART00000130310 Essential Splice Site 142 825 8 27
Genomic Location (Zv9):
Chromosome 24 (position 43686740)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 42087133
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCATGAGTCTCTGAACACTGAGTCGCGATTCACCTGAACGATTCCTTTC[A/T]GAACTKGCTGGATCCTGCCAAAGACATGAAGAAGCAGATCCGAGGTGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44206
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022349 Nonsense 302 821 14 26
ENSDART00000130310 Nonsense 302 825 14 27
Genomic Location (Zv9):
Chromosome 24 (position 43679947)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 42079049
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGGTGTGGAGATCATGCTGGGCGTGTGTTCGTCAGGCCTCCTCATCTA[C/A]AGAGACAGACTCCGCATCAACCGATTCGCCTGGCCTAAAGTGCTGAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44205
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022349 Nonsense 396 821 16 26
ENSDART00000130310 Nonsense 396 825 16 27
Genomic Location (Zv9):
Chromosome 24 (position 43678576)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 42077678
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACTCTGGGCTCTAAGTTCCGCTACAGCGGCCGGACGCAGGCTCAAACC[A/T]GACGCGCCAGCTCACAGATCGTGCGGCCCGCACCCTACTTCCAGCGCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37970
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022349 Nonsense 504 821 17 26
ENSDART00000130310 Nonsense 504 825 17 27
Genomic Location (Zv9):
Chromosome 24 (position 43674029)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 42073131
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTGCTGGTGGAGAACGTGATGATTCTGGAGGACGACGACGAAACCACC[A/T]GAGCCACAGAGCTGTCACTGCCCAGCCCAGCAACACCAGCCCGCCTCGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25219
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022349 Nonsense 753 821 24 26
ENSDART00000130310 Nonsense 757 825 25 27
Genomic Location (Zv9):
Chromosome 24 (position 43662596)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 42061502
KASP Assay ID:
554-7707.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACATAAAGACACTCACACTCTGGCAAACATACACACACTCATACATAT[A/T]GACATACTCTCATATGCATGCACGTACACACACACACTCCCAGACAAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link