tbxas1

Ensembl ID:
ENSDARG00000002249
ZFIN ID:
ZDB-GENE-030131-8805
Description:
thromboxane-A synthase [Source:RefSeq peptide;Acc:NP_991172]
Human Orthologue:
TBXAS1
Human Description:
thromboxane A synthase 1 (platelet) [Source:HGNC Symbol;Acc:11609]
Mouse Orthologue:
Tbxas1
Mouse Description:
thromboxane A synthase 1, platelet Gene [Source:MGI Symbol;Acc:MGI:98497]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9271 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9271
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047555 Essential Splice Site 65 546 3 16
ENSDART00000109497 Essential Splice Site 65 546 2 13
ENSDART00000144246 Essential Splice Site 65 546 3 14
Genomic Location:
Chromosome 18 (position 12153168)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACCCAAAGCCCTTGCCATTTATTGGGAACCKGATGATGTTCCGAAAC[G/A]TAAGAATTTWGGTTATTTTATGAAGCACAAAAGTCATTCTCTCCTATATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/24exnbyt