KCNA2 (2 of 2)

Ensembl ID:
ENSDARG00000002241
Description:
potassium voltage-gated channel, shaker-related subfamily, member 2 [Source:HGNC Symbol;Acc:6220]
Human Orthologue:
KCNA2
Human Description:
potassium voltage-gated channel, shaker-related subfamily, member 2 [Source:HGNC Symbol;Acc:6220]
Mouse Orthologue:
Kcna2
Mouse Description:
potassium voltage-gated channel, shaker-related subfamily, member 2 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20814 Nonsense Mutation detected in F1 DNA During 2017
sa2280 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa20814
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027398 Nonsense 91 493 1 2
Genomic Location (Zv9):
Chromosome 6 (position 49358297)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 49414373
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTTTTTTGACAGAAACCGCCCCAGCTTTGACGCCATTCTCTATTACTA[T/A]CAATCAGGCGGAAGGTTGCGGAGACCAGTCAATGTCACATTGGATGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2280
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027398 Nonsense 154 493 1 2
Genomic Location (Zv9):
Chromosome 6 (position 49358486)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 49414562
KASP Assay ID:
554-2435.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATTGCCTGACAATGAGTTTCAGAAGCAGGTCTGGTTGCTGTTCGAGTA[T/A]CCAGAAAGTTCAGGGCCAGCCAGGATTATAGCAATCRTATCTGTAATGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link