psmb6

Ensembl ID:
ENSDARG00000002240
ZFIN ID:
ZDB-GENE-990415-216
Description:
proteasome subunit beta type-6 [Source:RefSeq peptide;Acc:NP_571227]
Human Orthologue:
PSMB6
Human Description:
proteasome (prosome, macropain) subunit, beta type, 6 [Source:HGNC Symbol;Acc:9543]
Mouse Orthologue:
Psmb6
Mouse Description:
proteasome (prosome, macropain) subunit, beta type 6 Gene [Source:MGI Symbol;Acc:MGI:104880]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15051 Nonsense Available for shipment Available now
sa37796 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15051
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024082 Nonsense 57 232 3 6
ENSDART00000126779   None 122 None 3
Genomic Location (Zv9):
Chromosome 23 (position 44658955)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44726404
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGTGTGTTTGTGTGTAACAGATGGCTGATGWGATCTGTGCAGGGCTTA[T/A]ATCGCCAACCGGGTGACTGATAAACTCACACCAATCCACGACCGCATCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37796
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024082 Nonsense 170 232 5 6
ENSDART00000126779 Nonsense 60 122 2 3
Genomic Location (Zv9):
Chromosome 23 (position 44657089)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44724538
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCAGCCGGTGTCGGTCGGTGGATCCGGCAGCAGCTACATCTATGGATA[T/A]GTGGATTCAAACTACAGAAGCGGAATGAGCAAAGAAGAGTGTCTGAAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link