mmp14a

Ensembl ID:
ENSDARG00000002235
ZFIN ID:
ZDB-GENE-030901-1
Description:
matrix metalloproteinase-14 [Source:RefSeq peptide;Acc:NP_919397]
Human Orthologue:
MMP14
Human Description:
matrix metallopeptidase 14 (membrane-inserted) [Source:HGNC Symbol;Acc:7160]
Mouse Orthologue:
Mmp14
Mouse Description:
matrix metallopeptidase 14 (membrane-inserted) Gene [Source:MGI Symbol;Acc:MGI:101900]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13113 Nonsense Available for shipment Available now
sa20922 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13113
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005884 Nonsense 40 574 2 10
Genomic Location:
Chromosome 7 (position 25304497)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGCAMTAATGTGTCATTTGCTTTCTCCAAGGCATGGCTCCAGCAGTA[T/A]GGGTATCTTCCTCCTGGTGATGTTCGGGCTCAGGCGATTCGCTCTCCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20922
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005884 Essential Splice Site 227 574 4 10
Genomic Location:
Chromosome 7 (position 25299993)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTTTGATGAAGCAGAGCCTTGGACAACAGGCAACGTTGACAAGGGAG[G/A]TGAGGAAGATGATCTAGAATTGTGTCTAGGGTTTTAAATGTAAATTCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v1128b5r