si:dkey-103j14.5

Ensembl ID:
ENSDARG00000002219
ZFIN ID:
ZDB-GENE-090313-170
Description:
Novel asparaginase protein [Source:UniProtKB/TrEMBL;Acc:B8JHT8]
Human Orthologue:
ASRGL1
Human Description:
asparaginase like 1 [Source:HGNC Symbol;Acc:16448]
Mouse Orthologue:
Asrgl1
Mouse Description:
asparaginase like 1 Gene [Source:MGI Symbol;Acc:MGI:1913764]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9925 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9925
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051886 Essential Splice Site 202 307 4 6
ENSDART00000132828 Essential Splice Site 38 143 1 3
ENSDART00000144566   None 110 None 2
Genomic Location (Zv9):
Chromosome 13 (position 23465142)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23110802
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAATTCGAAACAAAATGGTGGGAAGAGTTGGTGATTCTCCYATTATAG[G/A]TGAGTCTGATCAGAKATGGAGGACAGAGCTAATCTCAGTGTMACAGCAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link