tbx3

Ensembl ID:
ENSDARG00000002216
ZFIN ID:
ZDB-GENE-070209-80
Description:
T-box transcription factor TBX3 [Source:RefSeq peptide;Acc:NP_001095140]
Human Orthologue:
TBX3
Human Description:
T-box 3 [Source:HGNC Symbol;Acc:11602]
Mouse Orthologue:
Tbx3
Mouse Description:
T-box 3 Gene [Source:MGI Symbol;Acc:MGI:98495]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1334 Essential Splice Site Available for shipment Available now
sa16346 Nonsense Available for shipment Available now
sa18035 Missense, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1334
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006380 Essential Splice Site 215 689 3 7
ENSDART00000122340 Essential Splice Site 215 279 3 4
Genomic Location:
Chromosome 5 (position 75418872)
KASP Assay ID:
554-1248.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTTAAAAATCACGAATATTTAATATAACGTCAGGCTAATTTGTGTTTT[A/G]GACGATACTAAACTCCATGCACAAATACCAGCCAAGATTTCACATCGTGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa16346
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006380 Nonsense 341 689 5 7
ENSDART00000122340 None None 279 None 4
Genomic Location:
Chromosome 5 (position 75420211)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCGYCAGGCTTCATCTCCTGCGGTCTCGACTGCTGGACACAATCATTTA[A/T]AAGGTACGACAGTCAGACAGACATGAGCCGTATGCATTTTCTCCTAGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18035
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006380 Missense 357 689 6 7
ENSDART00000122340 Nonsense 279 279 4 4
Genomic Location:
Chromosome 5 (position 75420679)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAGATTTCTGTGACAGCGATGAAGACAGYGATGAAGWAGACAAAGACG[C/T]GAACGCRAAAGAAGGGCCAGACTCCAGCAAAATCTCCACCACCACCGAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mugds3gl