invs

Ensembl ID:
ENSDARG00000002213
ZFIN ID:
ZDB-GENE-020507-2
Description:
Inversin [Source:UniProtKB/Swiss-Prot;Acc:Q8UVC1]
Human Orthologue:
INVS
Human Description:
inversin [Source:HGNC Symbol;Acc:17870]
Mouse Orthologue:
Invs
Mouse Description:
inversin Gene [Source:MGI Symbol;Acc:MGI:1335082]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36157 Nonsense Mutation detected in F1 DNA During 2016
sa36158 Essential Splice Site Mutation detected in F1 DNA During 2016
sa6435 Nonsense Mutation detected in F1 DNA During 2016
sa12246 Nonsense Available for shipment Available now
sa36159 Nonsense Mutation detected in F1 DNA During 2016
sa14224 Nonsense Available for shipment Available now
sa2837 Nonsense F2 line generated During 2016
sa12856 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36157
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015688 Nonsense 314 1025 9 18
Genomic Location (Zv9):
Chromosome 16 (position 29710034)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 27547172
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTTGCAGTGTTTCTGAAACACCACTCTGTAAGAGATGAGCCTGACCTA[G/T]AGGGACGAACCGCCTTCATGTGGGCCGCTGGGAAAGGCAGTAATGATGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36158
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015688 Essential Splice Site 404 1025 10 18
Genomic Location (Zv9):
Chromosome 16 (position 29710521)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 27547659
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTGCGTGCGAGATGGGCCATCGAGATGTCATACTAACACTCATTAAAG[G/A]TGTGTAAGTGCATGCATGCCTCCCCACTGGTGATGTTTTAAAAATAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6435
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015688 Nonsense 447 1025 11 18
Genomic Location (Zv9):
Chromosome 16 (position 29713315)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 27550453
KASP Assay ID:
554-4512.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTGTGTGAGGTGCTAATGGAGAATGGGATCAGTCCTAACCTGCAGGAC[C/T]AAGCTGGACGGACACCCTTACAGTGTGCAGCGTATGCTGGCTACATAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12246
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015688 Nonsense 494 1025 12 18
Genomic Location (Zv9):
Chromosome 16 (position 29713574)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 27550712
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATGTGTTAAGGGGAGAACCGCACTCCACTGGTCCTGTAATAATGGTTA[T/A]CTGGATGCTGTGAAGCTGTTGCTGGGGTGTGGGGCATTTCCCAATCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36159
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015688 Nonsense 690 1025 15 18
Genomic Location (Zv9):
Chromosome 16 (position 29721711)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 27558849
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTCCATCAGATCTCTCCCTCCAGTGACGCCAATGAGCACCAAGAAGTG[T/A]CCAGTCACCAGAGAGGAGGTGTGTGTGAGAGAAACATTTGGTCCAGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14224
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015688 Nonsense 763 1025 15 18
Genomic Location (Zv9):
Chromosome 16 (position 29721928)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 27559066
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACYACCCCAACCCCTAAACCAAGACCTAGTACTACAGGTGCCCACTCC[A/T]AAAATGCCTCCCAGGACACAYCACAACACAATGAGACACAGACAAYGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2837
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015688 Nonsense 828 1025 15 18
Genomic Location (Zv9):
Chromosome 16 (position 29722123)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 27559261
KASP Assay ID:
554-2538.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGACRCACAGAGAAAAGGATAAAAGATCAAGGACTGARGGAGATAAA[C/T]AGACTGTCAGAGAGAAACAGAAAGGCACRGGGATTGAGAGAGACAAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12856
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015688 Essential Splice Site 882 1025 15 18
Genomic Location (Zv9):
Chromosome 16 (position 29722288)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 27559426
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGTAGTAAAAACCAGGCTGCTGTTGTGATACAGAGRGCATGGAGAAGG[T/A]ACTTATGTCCTTTTACTACAAGAAGTACTTCATTCTGAGAAGCTTCAAYA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link