PYGL

Ensembl ID:
ENSDARG00000002197
Description:
phosphorylase, glycogen, liver [Source:HGNC Symbol;Acc:9725]
Human Orthologue:
PYGL
Human Description:
phosphorylase, glycogen, liver [Source:HGNC Symbol;Acc:9725]
Mouse Orthologue:
Pygl
Mouse Description:
liver glycogen phosphorylase Gene [Source:MGI Symbol;Acc:MGI:97829]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16886 Nonsense Available for shipment Available now
sa6325 Nonsense Mutation detected in F1 DNA During 2017
sa12138 Nonsense Available for shipment Available now
sa38964 Missense Mutation detected in F1 DNA During 2017
sa38963 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16886
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023449 Nonsense 161 965 4 31
Genomic Location (Zv9):
Chromosome 13 (position 37263010)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36735312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTAGACTCAATGGCRACTCTGGGTCTGGCAGCCTATGGATATGGGATA[C/T]GATATGAATATGGAATATTCAACCAGAAGATTAAAGATGGCWGGCAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6325
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023449 Nonsense 264 965 7 31
Genomic Location (Zv9):
Chromosome 13 (position 37259199)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36731501
KASP Assay ID:
554-5215.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAWAAATTCTTTATAAACTSTATTTATTTACAGTTAAYGTGGGTGATTA[C/A]ATTCAGGCAGTTTTGGACCGTAACTTAGCAGAAAACATTTCSCGTGTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12138
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023449 Nonsense 387 965 10 31
Genomic Location (Zv9):
Chromosome 13 (position 37256148)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36728450
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACRTTTGCYTACACAAACCACACGGTTCTGCCAGAGGCTCTGGAACGCTG[G/A]CCAGTTGATCTGATGGAGAAACTCTTACCGCGACACCTGCAGATCATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38964
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023449 Missense 542 965 16 31
Genomic Location (Zv9):
Chromosome 13 (position 37253760)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36726062
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGAATACAAACGGCAGCTGCTCAACTGCCTCCACGTCATCACCATGTA[C/A]AACCGTATGTATGCTACACAAACATAAACACACACTTGCGTTTTTATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38963
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023449 Nonsense 956 965 31 31
Genomic Location (Zv9):
Chromosome 13 (position 37248820)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 36721122
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCCACTGACCTGAAGATTCCTCCACCAGGCGAACCTCGTGAAGCTCTA[G/T]AGGAAACTGCACGCTCCCTGCGCAAGACCTGAAGACAAGATCATCAGATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link