rhd

Ensembl ID:
ENSDARG00000002194
ZFIN ID:
ZDB-GENE-051213-1
Description:
Rh blood group, D antigen [Source:RefSeq peptide;Acc:NP_001019990]
Human Orthologues:
RHCE, RHD
Human Descriptions:
Rh blood group, CcEe antigens [Source:HGNC Symbol;Acc:10008]
Rh blood group, D antigen [Source:HGNC Symbol;Acc:10009]
Mouse Orthologue:
Rhd
Mouse Description:
Rh blood group, D antigen Gene [Source:MGI Symbol;Acc:MGI:1202882]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42292 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42292
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020663 Essential Splice Site 53 423 None 10

The following transcripts of ENSDARG00000002194 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 46143014)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 45385922
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGAGTACAGAAGGTCTGAAAGTGAGCCCTTCGTCCACTCATATGCAGG[T/C]CAGTAAGTCTGAATTACAGTAAGGATTTGTTATGAATCTTTTAAAACCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link