rho

Ensembl ID:
ENSDARG00000002193
ZFIN ID:
ZDB-GENE-990415-271
Description:
Rhodopsin [Source:UniProtKB/Swiss-Prot;Acc:P35359]
Human Orthologue:
RHO
Human Description:
rhodopsin [Source:HGNC Symbol;Acc:10012]
Mouse Orthologue:
Rho
Mouse Description:
rhodopsin Gene [Source:MGI Symbol;Acc:MGI:97914]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21401 Nonsense Available for shipment Available now
sa31692 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21401
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027000 Nonsense 66 354 1 1
Genomic Location (Zv9):
Chromosome 8 (position 55708150)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53670035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCGGCTTCCCCGTCAACTTCCTCACGCTGTACGTCACCATCGAGCAC[A/T]AGAAGCTGCGCACACCCCTCAACTACATCCTGCTGAACCTGGCCATTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31692
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027000 Nonsense 265 354 1 1
Genomic Location (Zv9):
Chromosome 8 (position 55707551)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53669436
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGTCACCCGCATGGTCATCATCATGGTCATCGCCTTCCTCATCTGCTG[G/A]TTGCCCTACGCCGGCGTGGCCTGGTACATCTTCACCCACCAGGGCAGCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link