chmp2bl

Ensembl ID:
ENSDARG00000002190
ZFIN ID:
ZDB-GENE-040426-2539
Description:
Charged multivesicular body protein 2b [Source:UniProtKB/Swiss-Prot;Acc:Q6NXD2]
Human Orthologue:
CHMP2B
Human Description:
chromatin modifying protein 2B [Source:HGNC Symbol;Acc:24537]
Mouse Orthologue:
Chmp2b
Mouse Description:
chromatin modifying protein 2B Gene [Source:MGI Symbol;Acc:MGI:1916192]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13040 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13040
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018472 Essential Splice Site 12 214 None 6
ENSDART00000125682 Essential Splice Site 61 263 None 6
Genomic Location:
Chromosome 1 (position 33191413)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTTTGTTGCAGTWATGACATCGTTATTYAAGAAAAAGACCGTAGATGG[T/A]AAGTTTCTTGCCGCCGCTTTGAGTGCTTGTTTGTTTGTCAAAGCCGCCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7259qt0n