itfg2

Ensembl ID:
ENSDARG00000002174
ZFIN ID:
ZDB-GENE-041008-161
Description:
integrin alpha FG-GAP repeat containing 2 [Source:RefSeq peptide;Acc:NP_001017908]
Human Orthologue:
ITFG2
Human Description:
integrin alpha FG-GAP repeat containing 2 [Source:HGNC Symbol;Acc:30879]
Mouse Orthologue:
Itfg2
Mouse Description:
integrin alpha FG-GAP repeat containing 2 Gene [Source:MGI Symbol;Acc:MGI:1915450]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33447 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33447
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013313 Nonsense 158 436 5 12
Genomic Location (Zv9):
Chromosome 4 (position 16609871)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 17552711
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGAGCTTGTTGTTGGCTACACTGACCGAGTGGTCCGGGCCTTCAGATG[G/A]GAGGAACCTTCTGATGCTTCAGATATGAGCTCCGGTCAGCTGGTCCTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link