cacnb1

Ensembl ID:
ENSDARG00000002167
ZFIN ID:
ZDB-GENE-040718-399
Description:
voltage-dependent L-type calcium channel subunit beta-1 [Source:RefSeq peptide;Acc:NP_001002652]
Human Orthologue:
CACNB1
Human Description:
calcium channel, voltage-dependent, beta 1 subunit [Source:HGNC Symbol;Acc:1401]
Mouse Orthologue:
Cacnb1
Mouse Description:
calcium channel, voltage-dependent, beta 1 subunit Gene [Source:MGI Symbol;Acc:MGI:102522]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8705 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8705
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012835 Nonsense 241 520 7 14
ENSDART00000057159 None None 603 None 14
ENSDART00000111707 None None 478 None 13
ENSDART00000123068 Nonsense 241 642 7 14
ENSDART00000130611 Nonsense 241 517 7 13

The following transcripts of ENSDARG00000002167 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 15800732)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTGAGGAGGCGGAGACTGCCGACACCCGCGACCATAAGGGTGTGGGC[G/T]GAAGTGTCACCTCCCCTCAAGGCAACCTGCCCCGCCTCCCTTTCTTTAAR
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/w5th2uv2