cacnb1

Ensembl ID:
ENSDARG00000002167
ZFIN ID:
ZDB-GENE-040718-399
Description:
voltage-dependent L-type calcium channel subunit beta-1 [Source:RefSeq peptide;Acc:NP_001002652]
Human Orthologue:
CACNB1
Human Description:
calcium channel, voltage-dependent, beta 1 subunit [Source:HGNC Symbol;Acc:1401]
Mouse Orthologue:
Cacnb1
Mouse Description:
calcium channel, voltage-dependent, beta 1 subunit Gene [Source:MGI Symbol;Acc:MGI:102522]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33120 Nonsense Mutation detected in F1 DNA During 2016
sa8705 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa33120
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012835 Nonsense 114 520 4 14
ENSDART00000057159 Nonsense 114 603 4 14
ENSDART00000111707 Nonsense 114 478 4 13
ENSDART00000123068 Nonsense 114 642 4 14
ENSDART00000130611 Nonsense 114 517 4 13

The following transcripts of ENSDARG00000002167 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 15811735)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTGAAGACCAAGCCTGTAGCGTTTGCAGTGAGGACTAACGTTGGCTA[T/A]AACCCAGGCCCTAATGATGATGTGCCTGTTCAGGGCATGGCCATCTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8705
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012835 Nonsense 241 520 7 14
ENSDART00000057159   None 603 None 14
ENSDART00000111707   None 478 None 13
ENSDART00000123068 Nonsense 241 642 7 14
ENSDART00000130611 Nonsense 241 517 7 13

The following transcripts of ENSDARG00000002167 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 15800732)
KASP Assay ID:
2259-3197.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTGAGGAGGCGGAGACTGCCGACACCCGCGACCATAAGGGTGTGGGC[G/T]GAAGTGTCACCTCCCCTCAAGGCAACCTGCCCCGCCTCCCTTTCTTTAAR
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link