psme1

Ensembl ID:
ENSDARG00000002165
ZFIN ID:
ZDB-GENE-991110-17
Description:
proteasome activator complex subunit 1 [Source:RefSeq peptide;Acc:NP_571450]
Human Orthologue:
PSME1
Human Description:
proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) [Source:HGNC Symbol;Acc:9568]
Mouse Orthologue:
Psme1
Mouse Description:
proteasome (prosome, macropain) 28 subunit, alpha Gene [Source:MGI Symbol;Acc:MGI:1096367]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12220 Essential Splice Site Available for shipment Available now
sa6761 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa14800 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12220
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005105 Essential Splice Site 13 248 1 11

The following transcripts of ENSDARG00000002165 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 12850192)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 12801640
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTGCAGCAATGACTTCCTTAGACATGAGCCCCGCGTCCAAGAAACAGG[T/A]AAGCCGAATATKACAGGCCCAAAAGCTGAYATACACTCATTACATTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6761
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005105 Splice Site, Nonsense 45 248 3 11

The following transcripts of ENSDARG00000002165 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 12850632)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 12802080
KASP Assay ID:
554-5462.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATCTCGAAGATTTTCCCTGAGAAGATTGCAGAGATGGACAATGTGTTG[C/T]AGGTATGAAMTCAACCATTTAATATTAAGGCTTTATGAGTACATATTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14800
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005105 Essential Splice Site 173 248 8 11

The following transcripts of ENSDARG00000002165 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 12854041)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 12805489
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGACCAACACCCGCACCAAGATCGAAGGATTCCAGAYACAGATATCCAA[G/A]TAAGAGACCAGACTACATGACAACCACAGTCCAACACTAACCTTATGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link