celf2

Ensembl ID:
ENSDARG00000002131
ZFIN ID:
ZDB-GENE-030826-35
Description:
CUGBP Elav-like family member 2 [Source:UniProtKB/Swiss-Prot;Acc:Q6P0B1]
Human Orthologue:
CELF2
Human Description:
CUGBP, Elav-like family member 2 [Source:HGNC Symbol;Acc:2550]
Mouse Orthologue:
Celf2
Mouse Description:
CUGBP, Elav-like family member 2 Gene [Source:MGI Symbol;Acc:MGI:1338822]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11849 Essential Splice Site Available for shipment Available now
sa20284 Nonsense Mutation detected in F1 DNA During 2014
sa20283 Essential Splice Site Mutation detected in F1 DNA During 2014
sa2160 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa11849
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017443 None None 514 None 13
ENSDART00000077926 None None 493 None 13
ENSDART00000128368 None None 505 None 14
ENSDART00000129320 Essential Splice Site 93 585 2 15
ENSDART00000132615 None None 493 None 12
ENSDART00000133433 None None 468 None 12
ENSDART00000135942 None None 448 None 12
ENSDART00000138873 None None 208 None 5
ENSDART00000139439 None None 448 None 12
Genomic Location:
Chromosome 4 (position 22996017)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCTCTCACAGGCAGGACGCAAGTGATCTGACTGGAACTATACAGAGG[T/A]AAGACTGTCTCCATCTCTCGCTCTGTCAATTATTTGYACACACTTCTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20284
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017443 Nonsense 87 514 2 13
ENSDART00000077926 Nonsense 91 493 2 13
ENSDART00000128368 Nonsense 78 505 2 14
ENSDART00000129320 Nonsense 158 585 3 15
ENSDART00000132615 Nonsense 66 493 1 12
ENSDART00000133433 Nonsense 66 468 1 12
ENSDART00000135942 Nonsense 66 448 1 12
ENSDART00000138873 None None 208 None 5
ENSDART00000139439 Nonsense 66 448 1 12
Genomic Location:
Chromosome 4 (position 22899335)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACCAGATCAACATACTGCGAGACCGCAGCCAGAACCCACCACAGAGC[A/T]AAGGTAGAGCACGTTTCTTGTCTTTATGCATCACACATGTAGACCTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20283
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017443 Essential Splice Site 131 514 4 13
ENSDART00000077926 Essential Splice Site 135 493 4 13
ENSDART00000128368 Essential Splice Site 122 505 4 14
ENSDART00000129320 Essential Splice Site 202 585 5 15
ENSDART00000132615 Essential Splice Site 110 493 3 12
ENSDART00000133433 Essential Splice Site 110 468 3 12
ENSDART00000135942 Essential Splice Site 110 448 3 12
ENSDART00000138873 None None 208 None 5
ENSDART00000139439 Essential Splice Site 110 448 3 12
Genomic Location:
Chromosome 4 (position 22874281)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGCACCATCCCATACAGATGAAGCCCGCAGACAGTGAGAAATCAAATG[G/A]TGAGTGTCTCCTATATTTTGTCTCCAGTACGCTTGTCTTTCCATCTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2160
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017443 Nonsense 398 514 11 13
ENSDART00000077926 Nonsense 377 493 10 13
ENSDART00000128368 Nonsense 389 505 11 14
ENSDART00000129320 Nonsense 469 585 12 15
ENSDART00000132615 Nonsense 377 493 10 12
ENSDART00000133433 Nonsense 352 468 9 12
ENSDART00000135942 Nonsense 332 448 9 12
ENSDART00000138873 Nonsense 92 208 3 5
ENSDART00000139439 Nonsense 332 448 9 12
Genomic Location:
Chromosome 4 (position 22828693)
KASP Assay ID:
554-2888.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GKTCGGCCGGGCCTATGGACGCTCTCACACAGGCCTACTCAGGGATCCAA[C/T]AGTAYGCGGCTGCCGCCCTGCCCACCCTCTMCAGCCAGTCCCTACTGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uu2bvesh