hm:zehs0001

Ensembl ID:
ENSDARG00000002084
ZFIN IDs:
ZDB-GENE-030131-169, ZDB-GENE-030131-169, ZDB-GENE-081030-4
Description:
Novel protein similar to vertebrate laminin, beta 2 (Laminin S) (LAMB2) [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
LAMB2
Human Description:
laminin, beta 2 (laminin S) [Source:HGNC Symbol;Acc:6487]
Mouse Orthologue:
Lamb2
Mouse Description:
laminin, beta 2 Gene [Source:MGI Symbol;Acc:MGI:99916]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10763 Essential Splice Site Available for shipment Available now
sa5042 Nonsense Mutation detected in F1 DNA During 2014
sa5041 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10763
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012166 Essential Splice Site 330 1782 9 33
ENSDART00000147326 Essential Splice Site 330 1782 10 34
Genomic Location:
Chromosome 23 (position 20502053)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAGTGGCATAAATCTCTGATRTCATRGCTAATATATTTCTGTTTTTCCC[A/C]GAATGCAACTGTAATGGTCACTCCAACCAGTGTCATTTTGACATGGCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5042
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012166 Nonsense 1366 1782 26 33
ENSDART00000147326 Nonsense 1366 1782 27 34
Genomic Location:
Chromosome 23 (position 20480006)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAAGAAAACAGAGCGGCTGATTGGCCAAAAGAGAGATGATTTTAACCGC[A/T]AGAACGCTGCTAACAAGCGTACACTCACWGACTTAAATGCAAAAGTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5041
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012166 Nonsense 1652 1782 31 33
ENSDART00000147326 Nonsense 1652 1782 32 34
Genomic Location:
Chromosome 23 (position 20472277)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGATCTTAATGATGCAGTGGACAGACTGGGAGACCTGGAGCGCCAGATC[G/T]AGGCATTAAAGACCAAACGTGCCAACAACAGCCTGGATGCTGCACGGGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/08zoian9