hm:zehs0001

Ensembl ID:
ENSDARG00000002084
ZFIN IDs:
ZDB-GENE-030131-169, ZDB-GENE-030131-169, ZDB-GENE-081030-4
Description:
Novel protein similar to vertebrate laminin, beta 2 (Laminin S) (LAMB2) [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
LAMB2
Human Description:
laminin, beta 2 (laminin S) [Source:HGNC Symbol;Acc:6487]
Mouse Orthologue:
Lamb2
Mouse Description:
laminin, beta 2 Gene [Source:MGI Symbol;Acc:MGI:99916]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10763 Essential Splice Site Available for shipment Available now
sa43957 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10763
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012166 Essential Splice Site 330 1782 9 33
ENSDART00000147326 Essential Splice Site 330 1782 10 34
Genomic Location (Zv9):
Chromosome 23 (position 20502053)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20287160
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAGTGGCATAAATCTCTGATRTCATRGCTAATATATTTCTGTTTTTCCC[A/C]GAATGCAACTGTAATGGTCACTCCAACCAGTGTCATTTTGACATGGCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43957
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012166 Nonsense 394 1782 10 33
ENSDART00000147326 Nonsense 394 1782 11 34
Genomic Location (Zv9):
Chromosome 23 (position 20500759)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20285866
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACTGGGGTATAATAAACAATTGGTTTTTGTCTGCCCTTTGTTAGCTTG[C/A]GATTGTGACCCAGATGGCTCTAAGAACGGTGGTGTTTGTGACGGCCATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link