ck2a1

Ensembl ID:
ENSDARG00000002082
ZFIN ID:
ZDB-GENE-990415-27
Description:
casein kinase 2 alpha 1 [Source:RefSeq peptide;Acc:NP_571327]
Human Orthologue:
CSNK2A1
Human Description:
casein kinase 2, alpha 1 polypeptide [Source:HGNC Symbol;Acc:2457]
Mouse Orthologue:
Csnk2a1
Mouse Description:
casein kinase 2, alpha 1 polypeptide Gene [Source:MGI Symbol;Acc:MGI:88543]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25018 Nonsense Mutation detected in F1 DNA During 2016
sa42759 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa25018
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008297 Nonsense 41 395 5 15
ENSDART00000056551 Nonsense 41 395 5 16
ENSDART00000140880 Nonsense 41 140 5 8
ENSDART00000146886 Nonsense 41 141 5 8
ENSDART00000147373 Nonsense 41 232 5 11
Genomic Location:
Chromosome 16 (position 33749690)
KASP Assay ID:
554-7381.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTAAATTCTTATTGTATGTTGTGCAGAAACCAAGATGACTATCAGT[T/A]AGTGCGGAAGCTTGGCCGGGGAAAATACAGTGAAGTGTTCGAAGCCATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42759
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008297 Essential Splice Site 355 395 14 15
ENSDART00000056551 Essential Splice Site 355 395 14 16
ENSDART00000140880   None 140 None 8
ENSDART00000146886   None 141 None 8
ENSDART00000147373   None 232 None 11
Genomic Location:
Chromosome 16 (position 33746372)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAATGGCTGCTAGTTCCACACCCGTCAGCTCTTCTAGCTTGATGGCAGG[T/A]AAATGATTTATTTTCTCCACAGCACTTCATCTCTGTTTGAAATAACTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link