ck2a1

Ensembl ID:
ENSDARG00000002082
ZFIN ID:
ZDB-GENE-990415-27
Description:
casein kinase 2 alpha 1 [Source:RefSeq peptide;Acc:NP_571327]
Human Orthologue:
CSNK2A1
Human Description:
casein kinase 2, alpha 1 polypeptide [Source:HGNC Symbol;Acc:2457]
Mouse Orthologue:
Csnk2a1
Mouse Description:
casein kinase 2, alpha 1 polypeptide Gene [Source:MGI Symbol;Acc:MGI:88543]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25018 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25018
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008297 Nonsense 41 395 5 15
ENSDART00000056551 Nonsense 41 395 5 16
ENSDART00000140880 Nonsense 41 140 5 8
ENSDART00000146886 Nonsense 41 141 5 8
ENSDART00000147373 Nonsense 41 232 5 11
Genomic Location:
Chromosome 16 (position 33749690)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTAAATTCTTATTGTATGTTGTGCAGAAACCAAGATGACTATCAGT[T/A]AGTGCGGAAGCTTGGCCGGGGAAAATACAGTGAAGTGTTCGAAGCCATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/njb8p3ce