mnat1

Ensembl ID:
ENSDARG00000002077
ZFIN ID:
ZDB-GENE-041010-203
Description:
CDK-activating kinase assembly factor MAT1 [Source:RefSeq peptide;Acc:NP_001006100]
Human Orthologue:
MNAT1
Human Description:
menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis) [Source:HGNC Symbol;Acc:7181]
Mouse Orthologue:
Mnat1
Mouse Description:
menage a trois 1 Gene [Source:MGI Symbol;Acc:MGI:106207]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1249 Nonsense F2 line generated During 2014
sa4514 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1249
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006648 Nonsense 124 309 4 8
Genomic Location:
Chromosome 13 (position 31883270)
KASP Assay ID:
554-1164.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAACCTGGCCAATAACATGGATGTAGAAATGACCAAGCAGAAGATGGAA[C/T]AGTATCAGCGAGATAACAAAGATGTTATACAGAGAAACAAAGCAAAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4514
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006648 Nonsense 217 309 6 8
Genomic Location:
Chromosome 13 (position 31884670)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACATAAAGACAGAGCAGCCCATCTAGAGACCCAGATAGAAAAACAGAAA[C/T]AAAACGTCAAACCCACAAACATCTTCTCGACTGGAATAATGATGGTGAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ozciy4ij