mnat1

Ensembl ID:
ENSDARG00000002077
ZFIN ID:
ZDB-GENE-041010-203
Description:
CDK-activating kinase assembly factor MAT1 [Source:RefSeq peptide;Acc:NP_001006100]
Human Orthologue:
MNAT1
Human Description:
menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis) [Source:HGNC Symbol;Acc:7181]
Mouse Orthologue:
Mnat1
Mouse Description:
menage a trois 1 Gene [Source:MGI Symbol;Acc:MGI:106207]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42235 Essential Splice Site Mutation detected in F1 DNA During 2016
sa1249 Nonsense F2 line generated During 2016
sa35529 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42235
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006648 Essential Splice Site 106 309 3 8
Genomic Location (Zv9):
Chromosome 13 (position 31881673)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31527621
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCTCTGACTGAGTATAATGACTATCTGGAGCAGGTGGAAGACATCGG[T/C]GAGATGTATATACAGCATTAAATCATTTATATTTTTGCCCCTGTTCTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1249
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006648 Nonsense 124 309 4 8
Genomic Location (Zv9):
Chromosome 13 (position 31883270)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31529218
KASP Assay ID:
554-1164.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAACCTGGCCAATAACATGGATGTAGAAATGACCAAGCAGAAGATGGAA[C/T]AGTATCAGCGAGATAACAAAGATGTTATACAGAGAAACAAAGCAAAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35529
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006648 Nonsense 270 309 7 8
Genomic Location (Zv9):
Chromosome 13 (position 31893596)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31539544
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTACATTGACACATATGGGCCGCCTGTTCCAGAATTGGATCAGCTAGGC[C/T]GAAAAGGGTAAGAATCACTTGCACTTCCTAAATGTATTGTGTTATATGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link