adss

Ensembl ID:
ENSDARG00000002071
ZFIN ID:
ZDB-GENE-050417-337
Description:
Adenylosuccinate synthetase isozyme 2 [Source:UniProtKB/Swiss-Prot;Acc:Q568F6]
Human Orthologue:
ADSS
Human Description:
adenylosuccinate synthase [Source:HGNC Symbol;Acc:292]
Mouse Orthologue:
Adss
Mouse Description:
adenylosuccinate synthetase, non muscle Gene [Source:MGI Symbol;Acc:MGI:87948]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa813 Nonsense Available for shipment Available now
sa35431 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa813
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018155 Nonsense 76 455 2 13
Genomic Location (Zv9):
Chromosome 13 (position 11234196)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 11386228
KASP Assay ID:
554-0717.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGGGAGGCAACAACGCAGGACACACCGTCGTGGTTGATTCAGTTGAATA[T/G]GATTTCCACCTTCTACCCAGTGGGATTATCAACCCTAAGGTCACTGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35431
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018155 Essential Splice Site 314 455 9 13
Genomic Location (Zv9):
Chromosome 13 (position 11213229)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 11365261
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACACCACCAGAGTTGGGATTGGAGCTTTCCCTACGGAACAGAGCAATG[T/A]AAGCAGCTGCCGAACTTCCTCTTTTGTGTGTGCGGATGCTTAATGAGCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link