LOC564852

Ensembl ID:
ENSDARG00000002037
Human Orthologue:
PFKFB2
Human Description:
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 [Source:HGNC Symbol;Acc:8873]
Mouse Orthologue:
Pfkfb2
Mouse Description:
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 Gene [Source:MGI Symbol;Acc:MGI:107815]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14301 Essential Splice Site Available for shipment Available now
sa21882 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14301
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036110 Essential Splice Site 213 539 7 15
Genomic Location:
Chromosome 11 (position 19214395)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGTTATAAGGTCACTTACCAGCCGCTWGATCCTGATGAATATGACAAG[T/C]AAGARTACTTGCAAAATGGACATGTTATGGTGTATCTAAATGTATAWACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21882
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036110 Nonsense 311 539 9 15
Genomic Location:
Chromosome 11 (position 19212595)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAGCTATCTAACCTGAAGGTTTGGACAAGCCAGTTAAGGAGAACCATC[C/T]AGACGGCTGAGGAGCTGGGAGTTCCCTATGAACAGTGGAAAATCCTCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sk79n7tw