LOC564852

Ensembl ID:
ENSDARG00000002037
Human Orthologue:
PFKFB2
Human Description:
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 [Source:HGNC Symbol;Acc:8873]
Mouse Orthologue:
Pfkfb2
Mouse Description:
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 Gene [Source:MGI Symbol;Acc:MGI:107815]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14301 Essential Splice Site Available for shipment Available now
sa21882 Nonsense Available for shipment Available now
sa41809 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14301
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036110 Essential Splice Site 213 539 7 15
Genomic Location (Zv9):
Chromosome 11 (position 19214395)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18631709
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGTTATAAGGTCACTTACCAGCCGCTWGATCCTGATGAATATGACAAG[T/C]AAGARTACTTGCAAAATGGACATGTTATGGTGTATCTAAATGTATAWACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21882
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036110 Nonsense 311 539 9 15
Genomic Location (Zv9):
Chromosome 11 (position 19212595)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18629909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAGCTATCTAACCTGAAGGTTTGGACAAGCCAGTTAAGGAGAACCATC[C/T]AGACGGCTGAGGAGCTGGGAGTTCCCTATGAACAGTGGAAAATCCTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41809
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000036110 Nonsense 458 539 14 15
Genomic Location (Zv9):
Chromosome 11 (position 19210105)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 18627419
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTTTAACCCACCCAGTCTCTTCCATTTTAAAGCAGGGGAAAGTGAGA[C/T]GAGACTGCGCTCCTCTGCTGTTAAGGCGGAATAGTTACACCCCTCTGTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link