si:ch73-47d4.1

Ensembl ID:
ENSDARG00000002026
ZFIN ID:
ZDB-GENE-081028-54
Description:
Novel protein similar to vertebrate quaking homolog, KH domain RNA binding (Mouse) (QKI) [Source:Uni
Human Orthologue:
QKI
Human Description:
quaking homolog, KH domain RNA binding (mouse) [Source:HGNC Symbol;Acc:21100]
Mouse Orthologue:
Qk
Mouse Description:
quaking Gene [Source:MGI Symbol;Acc:MGI:97837]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22202 Essential Splice Site Available for shipment Available now
sa22203 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22202
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018737 Essential Splice Site 47 345 1 7
ENSDART00000131553 Essential Splice Site 47 95 1 2
ENSDART00000139958   None 159 None 4

The following transcripts of ENSDARG00000002026 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 3319227)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 3534148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCAACTTCTGCGGGATCTTCAACCACCTCGAACGGCTTCTCGATGAAG[G/A]TAATGTTGATGGACTGACTTGTGTCCGTCAAATCCCACCGGGATGAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22203
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018737 Essential Splice Site 95 345 None 7
ENSDART00000131553   95 95 None 2
ENSDART00000139958   None 159 None 4

The following transcripts of ENSDARG00000002026 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 3370626)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 3585547
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTCAGCTCCAAGAGAAACTCTATGTGCCTGTTAAGGAATATCCTGATG[T/C]GAGTCTCAAAGCCTAAACACACCGACTGACACGCTTCCCTGCAGATGCGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link