si:dkey-120e24.2

Ensembl ID:
ENSDARG00000002020
ZFIN ID:
ZDB-GENE-091113-14
Human Orthologue:
RICTOR
Human Description:
RPTOR independent companion of MTOR, complex 2 [Source:HGNC Symbol;Acc:28611]
Mouse Orthologue:
Rictor
Mouse Description:
RPTOR independent companion of MTOR, complex 2 Gene [Source:MGI Symbol;Acc:MGI:1926007]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18403 Nonsense Available for shipment Available now
sa14901 Nonsense Available for shipment Available now
sa23914 Nonsense Available for shipment Available now
sa3126 Nonsense F2 line generated During 2017
sa37289 Nonsense Mutation detected in F1 DNA During 2017
sa1469 Nonsense Available for shipment Available now
sa23915 Essential Splice Site Available for shipment Available now
sa43626 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18403
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058311 Nonsense 55 1724 3 38
ENSDART00000142961 Nonsense 19 1698 1 36
Genomic Location (Zv9):
Chromosome 21 (position 20029273)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21164762
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCCTCCGAGAACATGCGAGAGATCCTGCAGAATGTGGCCAAACAACAA[G/T]GAGTCTCCAACATGCGGAAACTCGGCCATCTTAACAACTTTATCAAGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14901
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058311 Nonsense 132 1724 5 38
ENSDART00000142961 Nonsense 96 1698 3 36
Genomic Location (Zv9):
Chromosome 21 (position 20036045)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21171534
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAGGGACAGTAATATCCTTCAGAAGGTGTTGCGTCTCCAGGTGGATTA[C/A]CTGATTTCCAGGTCTGTWMCACGTTTTATTGCACTAAATKGGGGTCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23914
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058311 Nonsense 482 1724 17 38
ENSDART00000142961 Nonsense 446 1698 15 36
Genomic Location (Zv9):
Chromosome 21 (position 20045872)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21181361
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTTGGTTGTGTTTTGTAGACGGGCGAGTGCTGCGGTTAATTACTTG[A/T]AGAGATTTCATGAGAAGAAGAAGCGAGGCCCCAAACCCAATAGTCTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3126
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058311 Nonsense 1021 1724 30 38
ENSDART00000142961 Nonsense 985 1698 28 36
Genomic Location (Zv9):
Chromosome 21 (position 20057922)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21193411
KASP Assay ID:
554-3214.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTTTGGCCTGTGGTCCCCGATGAGGTGGAGCAGCACCAGAACCTACAG[C/T]AGCAGCAGCAACAGCACCAGCAACCCCTCATTCACCTATCRTCAGCTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37289
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058311 Nonsense 1022 1724 30 38
ENSDART00000142961 Nonsense 986 1698 28 36
Genomic Location (Zv9):
Chromosome 21 (position 20057925)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21193414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGGCCTGTGGTCCCCGATGAGGTGGAGCAGCACCAGAACCTACAGCAG[C/T]AGCAGCAACAGCACCAGCAACCCCTCATTCACCTATCGTCAGCTCCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1469
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058311 Nonsense 1220 1724 31 38
ENSDART00000142961 Nonsense 1184 1698 29 36
Genomic Location (Zv9):
Chromosome 21 (position 20061106)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21196595
KASP Assay ID:
554-1394.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TRAACAGAACTGCAGAACGAAGCTCAGGGGTAGGAGATACCCACCGTGAA[C/T]AAACCAGTCGAGAAAGGCTTGCCGGTGATGGCTCAACCTCTGGAAGCGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23915
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058311   None 1724 None 38
ENSDART00000142961 Essential Splice Site 1462 1698 31 36
Genomic Location (Zv9):
Chromosome 21 (position 20064537)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21200026
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGGGCTGCAAAGTTCTTCTCGGGCGAGGCAGATGGTAAAGATAAAAATG[G/A]TTACTGAATATTGTATCAGTAGCTCGTTATTCTGCATACAAATCCAATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43626
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058311 Nonsense 1587 1724 35 38
ENSDART00000142961 Nonsense 1561 1698 33 36
Genomic Location (Zv9):
Chromosome 21 (position 20066030)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21201519
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGCAATCAGTCCATACACAACCTGGAAGTGATGCCTCAGTCTAAGTA[C/A]TCTGGAGTGTCAGGCTGCAGCGACGCCGTCTCTCAGGGCTCTGGTGGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link