ppil2

Ensembl ID:
ENSDARG00000002016
ZFIN ID:
ZDB-GENE-040426-1096
Description:
peptidyl-prolyl cis-trans isomerase-like 2 [Source:RefSeq peptide;Acc:NP_957285]
Human Orthologue:
PPIL2
Human Description:
peptidylprolyl isomerase (cyclophilin)-like 2 [Source:HGNC Symbol;Acc:9261]
Mouse Orthologue:
Ppil2
Mouse Description:
peptidylprolyl isomerase (cyclophilin)-like 2 Gene [Source:MGI Symbol;Acc:MGI:2447857]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13568 Nonsense Available for shipment Available now
sa31417 Essential Splice Site, Missense Available for shipment Available now

Mutation Details

Allele Name:
sa13568
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025368 Nonsense 133 487 8 19
ENSDART00000051663 Nonsense 133 524 8 20
Genomic Location (Zv9):
Chromosome 5 (position 14128778)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12426215
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGYTTTACATAAAATYGTGTGCATTTGTGTGTGTTTTAAGRCAGTAGAG[C/T]AGCTCAACATTAAGACCAAGAGTTATAAAGACCTGTTGACGGATGAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31417
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025368 Essential Splice Site 288 487 12 19
ENSDART00000051663 Missense 289 524 12 20
Genomic Location (Zv9):
Chromosome 5 (position 14145065)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 12442502
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACCAGTATGTTAAGAAGAAAGGCTACGTGCGCTTGCACACAAACAAAG[G/A]AGACCTGAATGTGGAGTTACATTGTGATAAGGTATTCATTTCCCACTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link