grb10a

Ensembl ID:
ENSDARG00000002013
ZFIN ID:
ZDB-GENE-040822-32
Description:
growth factor receptor-bound protein 10a [Source:RefSeq peptide;Acc:NP_001004287]
Human Orthologue:
GRB10
Human Description:
growth factor receptor-bound protein 10 [Source:HGNC Symbol;Acc:4564]
Mouse Orthologue:
Grb10
Mouse Description:
growth factor receptor bound protein 10 Gene [Source:MGI Symbol;Acc:MGI:103232]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36838 Essential Splice Site Mutation detected in F1 DNA During 2016
sa63 Nonsense Available for shipment Available now
sa36837 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36838
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042172 Essential Splice Site 266 602 6 16
ENSDART00000140665 Essential Splice Site 266 602 7 17
Genomic Location:
Chromosome 19 (position 23643081)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTCTTCAGGAAGAACTACGCCAAGTATGAGTTCTTTAGAAACCCACTG[G/A]TAAGAGAAACAGCCTGTCCAATACAGCCCACCCATGCGTTTCTTTTAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa63
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042172 Nonsense 348 602 9 16
ENSDART00000140665 Nonsense 348 602 10 17
Genomic Location:
Chromosome 19 (position 23636987)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTATAATTGTGTTTTAGGAACCAAGGCACCTGCAATTACTGTCAGACT[T/A]GGAGGAGAGCAATATCTTTACTGTGACGACAGGCAGAAAGATGCACAATG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa36837
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042172 Nonsense 501 602 14 16
ENSDART00000140665 Nonsense 501 602 15 17
Genomic Location:
Chromosome 19 (position 23627691)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAATTTGCTTTTTGTGTTTGTTCTCAGTGATCCACAGGACACAGTTATG[G/A]TTCCACGGCCGCATTATGAGAGAGGAATCCCACAGGATGATTATGCAGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link