grb10a

Ensembl ID:
ENSDARG00000002013
ZFIN ID:
ZDB-GENE-040822-32
Description:
growth factor receptor-bound protein 10a [Source:RefSeq peptide;Acc:NP_001004287]
Human Orthologue:
GRB10
Human Description:
growth factor receptor-bound protein 10 [Source:HGNC Symbol;Acc:4564]
Mouse Orthologue:
Grb10
Mouse Description:
growth factor receptor bound protein 10 Gene [Source:MGI Symbol;Acc:MGI:103232]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa63 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa63
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042172 Nonsense 348 602 9 16
ENSDART00000140665 Nonsense 348 602 10 17
Genomic Location:
Chromosome 19 (position 23636987)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTATAATTGTGTTTTAGGAACCAAGGCACCTGCAATTACTGTCAGACT[T/A]GGAGGAGAGCAATATCTTTACTGTGACGACAGGCAGAAAGATGCACAATG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/l0sy21hm