adamts18

Ensembl ID:
ENSDARG00000001999
ZFIN ID:
ZDB-GENE-070815-1
Human Orthologue:
ADAMTS18
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 18 [Source:HGNC Symbol;Acc:17110]
Mouse Orthologue:
Adamts18
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 18 Gene

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14714 Nonsense Available for shipment Available now
sa21040 Nonsense Mutation detected in F1 DNA During 2014
sa18885 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8279 Essential Splice Site Mutation detected in F1 DNA During 2014
sa2353 Nonsense F2 line generated During 2014
sa12213 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14714
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004120 Nonsense 64 1244 3 23
Genomic Location:
Chromosome 7 (position 43059006)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGATGTTGACTCGTGTGATTTAAACTGTGTTTGTTTCACCCACAGATTA[T/A]GATTTTGCCACACCAGTGGAAGTGGACTCCTATGGAGGCTACATTTCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21040
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004120 Nonsense 295 1244 5 23
Genomic Location:
Chromosome 7 (position 43031846)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGAGTTTGAGCAGCAAATCCGAGTAAAACGCTCAGAGATCACATCGAGC[A/T]AAGAGGGTGGGCTGAACGTGGAAACTCTGGTGGTGGCAGACCGGAAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18885
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004120 Essential Splice Site 769 1244 16 23
ENSDART00000004120 Essential Splice Site 769 1244 16 23
Genomic Location:
Chromosome 7 (position 43005566)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAAGTCAGCAGACATGGTGAACCCATTTTTTCTCCTTTTCCCTTCTC[A/T]GAGTATTACCCTGTTGTGATGGTTCCTGCCGGCGCGAGGAGCATTCAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8279
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004120 Essential Splice Site 769 1244 16 23
ENSDART00000004120 Essential Splice Site 769 1244 16 23
Genomic Location:
Chromosome 7 (position 43005566)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAAGTCAGCAGACATGGTGAACCCATTTTTTCTCCTTTTCCCTTCTC[A/T]GAGTWTTACCCTGTTGTGATGGTTCCTGCCGGCGCGAGGAGCATTCAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2353
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004120 Nonsense 975 1244 19 23
Genomic Location:
Chromosome 7 (position 42985459)
KASP Assay ID:
554-2668.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAGGAAGGTGACGTACCAGCGGGAGGAGGTGGCSGCTCAGTCCTTGTG[C/A]CCAGTAATGGCTCCGGCTCAACTACAGCCCTGCAACACACAGTCATGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12213
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004120 Essential Splice Site 1146 1244 21 23
Genomic Location:
Chromosome 7 (position 42981082)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCGGACCTTCTGTGACACTGGGCTGGTACTCTTCTCCTTGGCTGCAGG[T/C]TTGTGTAACTAGCTCTTCATAACTAATCAGTCCTTTGTTSTGTCTCTATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide association and follow-up replication studies identified ADAMTS18 and TGFBR3 as bone mass candidate genes in different ethnic groups. (View Study)
  • White matter integrity: A genome-wide search for genetic influences and biological pathways related to the brain's white matter integrity. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/55nbbt9s