myhb

Ensembl ID:
ENSDARG00000001993
ZFIN ID:
ZDB-GENE-081124-1
Description:
LOC100002040 protein [Source:UniProtKB/TrEMBL;Acc:A7E2L9]
Human Orthologues:
MYH6, MYH7
Human Descriptions:
myosin, heavy chain 6, cardiac muscle, alpha [Source:HGNC Symbol;Acc:7576]
myosin, heavy chain 7, cardiac muscle, beta [Source:HGNC Symbol;Acc:7577]
Mouse Orthologues:
Myh6, Myh7
Mouse Descriptions:
myosin, heavy polypeptide 6, cardiac muscle, alpha Gene [Source:MGI Symbol;Acc:MGI:97255]
myosin, heavy polypeptide 7, cardiac muscle, beta Gene [Source:MGI Symbol;Acc:MGI:2155600]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25345 Nonsense Mutation detected in F1 DNA During 2014
sa18118 Nonsense Available for shipment Available now
sa17247 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa25345
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026257 Nonsense 1579 1939 32 39
Genomic Location:
Chromosome 6 (position 40678338)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTCGCGTTCAGCTTGAACTGAACCAAGTGAAAGGAGAGATTGATCGG[A/T]AATTGGCCGAGAAGGATGAGGAGATTGAACAGATTAAGCGAAACAGCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18118
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026257 Nonsense 1624 1939 32 39
Genomic Location:
Chromosome 6 (position 40678203)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CKGAAGTCAGAAGCAGAAACGATGCTCTGAGAATCAAAAAGAAGATGGAA[G/T]GAGACCTGAACGAGATGGAGATTCAGCTAAGCCATGCAAAYCGGCAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17247
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026257 Essential Splice Site 1765 1939 34 39
Genomic Location:
Chromosome 6 (position 40677608)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGGAAGCTCRAAATGCTGAAGAGAAGGCAAAGAAAGCTATAACTGAT[G/T]TAAGTAAATCTGTTCATGGATAATTNNNNNNNAAGTTTTCAAGATGTTGCATGTAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ccmluncr