si:ch211-13k12.1

Ensembl ID:
ENSDARG00000001976
ZFIN ID:
ZDB-GENE-050208-116
Description:
Novel protein (Si:ch211-13k12.1) [Source:UniProtKB/TrEMBL;Acc:A2BI98]
Human Orthologue:
FKBP8
Human Description:
FK506 binding protein 8, 38kDa [Source:HGNC Symbol;Acc:3724]
Mouse Orthologue:
Fkbp8
Mouse Description:
FK506 binding protein 8 Gene [Source:MGI Symbol;Acc:MGI:1341070]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23310 Nonsense Available for shipment Available now
sa36654 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23310
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007856   None 430 None 8
ENSDART00000097167 Nonsense 30 504 1 8
Genomic Location (Zv9):
Chromosome 18 (position 25437158)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 25666931
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGGAGATCCAGAGGAGACAACATTGGAAACTGAGATGTTTGCGAAAT[C/A]AGAAGAGCTGAAAAGTGAAGAAAGTGTTTTGCAGCCCTGGGAGGAACCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36654
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007856 Essential Splice Site 270 430 5 8
ENSDART00000097167 Essential Splice Site 344 504 5 8
Genomic Location (Zv9):
Chromosome 18 (position 25524388)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 25754161
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATAATTGTTTGGGGTTATACAACGAGGCTGTAAAATTGTCCTCCTAC[A/T]GATGGTCAAAACTGTGTGGCAGAGGAAGAAGAAGAAGTGAACGATTATCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link