hsd11b2

Ensembl ID:
ENSDARG00000001975
ZFIN ID:
ZDB-GENE-030131-6030
Description:
corticosteroid 11-beta-dehydrogenase isozyme 2 [Source:RefSeq peptide;Acc:NP_997885]
Human Orthologue:
HSD11B2
Human Description:
hydroxysteroid (11-beta) dehydrogenase 2 [Source:HGNC Symbol;Acc:5209]
Mouse Orthologue:
Hsd11b2
Mouse Description:
hydroxysteroid 11-beta dehydrogenase 2 Gene [Source:MGI Symbol;Acc:MGI:104720]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21003 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21003
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025665 Nonsense 133 400 2 5
ENSDART00000141211 Nonsense 147 414 2 5
Genomic Location (Zv9):
Chromosome 7 (position 36573117)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34846960
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTTCATCACGACTTACCCTCCTGCAAGTAGACATCACCCAGCCTCAG[C/T]AGGTACAGCAAGCCCTGCTCGACACCAAGGCCAAACTTGGCATAAGAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link