tpst2

Ensembl ID:
ENSDARG00000001972
ZFIN ID:
ZDB-GENE-040426-1400
Description:
protein-tyrosine sulfotransferase 2 [Source:RefSeq peptide;Acc:NP_956713]
Human Orthologue:
TPST2
Human Description:
tyrosylprotein sulfotransferase 2 [Source:HGNC Symbol;Acc:12021]
Mouse Orthologue:
Tpst2
Mouse Description:
protein-tyrosine sulfotransferase 2 Gene [Source:MGI Symbol;Acc:MGI:1309516]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13323 Nonsense Available for shipment Available now
sa1942 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13323
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015395 Nonsense 190 356 3 6
Genomic Location:
Chromosome 11 (position 21590270)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAGACGGGTCACCATCGCCGGCTTCGACCTGTCCAGCTACAGAGACTG[T/A]CWGACTAAGTGGAGCAGCGCCATTCAGGCCATGCTGTCSCAGTGCATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1942
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015395 Nonsense 218 356 3 6
Genomic Location:
Chromosome 11 (position 21590186)
KASP Assay ID:
554-1930.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTCSCAGTGCATGGCTGTGGGCTCACGCCGCTGTCTCACCGTCCGATA[T/G]GAGGATCTGGTGCTGCGACCGCGAACCTCCATGCAGAGAGTGCTGCTTTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y60qfj57