cthrc1b

Ensembl ID:
ENSDARG00000001971
ZFIN ID:
ZDB-GENE-050420-46
Description:
Novel protein similar to vertebrate collagen triple helix repeat containing 1 (CTHRC1) [Source:UniPr
Human Orthologue:
CTHRC1
Human Description:
collagen triple helix repeat containing 1 [Source:HGNC Symbol;Acc:18831]
Mouse Orthologue:
Cthrc1
Mouse Description:
collagen triple helix repeat containing 1 Gene [Source:MGI Symbol;Acc:MGI:1915838]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11817 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11817
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023958 Essential Splice Site 113 233 3 4
ENSDART00000147072 Essential Splice Site 74 194 2 3
Genomic Location:
Chromosome 16 (position 50672788)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTGTGTTTTGTTCCTCAGACTGATGYGCTGGGCTGTGTTTGTGTCGTC[A/G]GGAGTGCACGTTCACTAARCAGTATGCAGACAGTGCTCTGCGTGTGCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3a1wj1uh