dock5

Ensembl ID:
ENSDARG00000001968
ZFIN ID:
ZDB-GENE-080108-4
Description:
dedicator of cytokinesis protein 5 [Source:RefSeq peptide;Acc:NP_001103482]
Human Orthologue:
DOCK5
Human Description:
dedicator of cytokinesis 5 [Source:HGNC Symbol;Acc:23476]
Mouse Orthologue:
Dock5
Mouse Description:
dedicator of cytokinesis 5 Gene [Source:MGI Symbol;Acc:MGI:2652871]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21189 Essential Splice Site Available for shipment Available now
sa1688 Essential Splice Site Available for shipment Available now
sa34291 Essential Splice Site Available for shipment Available now
sa41113 Nonsense Mutation detected in F1 DNA During 2017
sa12362 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21189
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015126 Essential Splice Site 189 1854 6 50
ENSDART00000135834 Essential Splice Site 202 1867 7 51
Genomic Location (Zv9):
Chromosome 8 (position 7349931)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 6736734
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACGAGTCGGCATCTCACAGCATTGACGAGAGGATACAGGAGGAGAAG[G/A]TAAAGCACTTGATTTCGCTGTGTGCATTAGCGAATTTGTTGATTTGCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1688
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015126 Essential Splice Site 190 1854 7 50
ENSDART00000135834 Essential Splice Site 203 1867 8 51
Genomic Location (Zv9):
Chromosome 8 (position 7347254)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 6734057
KASP Assay ID:
554-1634.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAGGGCTTTTGCTTTTTATCCTGTTTTATTTATTTGTTTCTTTTTGTT[A/T]GATGCGCCTGCAGAACCTGGAGAAGCGGAGACAGAGCCTTTTTAGTGGCG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa34291
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015126 Essential Splice Site 190 1854 7 50
ENSDART00000135834 Essential Splice Site 203 1867 8 51
Genomic Location (Zv9):
Chromosome 8 (position 7347253)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 6734056
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGGGCTTTTGCTTTTTATCCTGTTTTATTTATTTGTTTCTTTTTGTTA[G/T]ATGCGCCTGCAGAACCTGGAGAAGCGGAGACAGAGCCTTTTTAGTGGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41113
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015126 Nonsense 805 1854 23 50
ENSDART00000135834 Nonsense 818 1867 24 51
Genomic Location (Zv9):
Chromosome 8 (position 7304365)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 6691168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATTAAATTCAATATATATATATTTTTTACAGGGAGCAATCTTGAAATA[T/G]CTTCCCACCATCATCAATGATTTGCAGAAGGTCTTTGATGCTGTGGAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12362
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015126 Nonsense 1433 1854 40 50
ENSDART00000135834 Nonsense 1446 1867 41 51
ENSDART00000015126 Nonsense 1433 1854 40 50
ENSDART00000135834 Nonsense 1446 1867 41 51
Genomic Location (Zv9):
Chromosome 8 (position 7259368)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 6646171
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCAGTCCTAAACTTACCTTCCCATTTCAAGGACAAGGGACTACCTGAA[C/T]AAATCCTCAAGTATAACTTTTTATTCACATCTTTCACGATTGAGATCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link