NP_998562.1

Ensembl ID:
ENSDARG00000001953
Description:
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 [Source:RefSeq peptide;Acc:NP_998562]
Human Orthologue:
PFKFB3
Human Description:
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 [Source:HGNC Symbol;Acc:8874]
Mouse Orthologue:
Pfkfb3
Mouse Description:
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 Gene [Source:MGI Symbol;Acc:MGI:2181202]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11437 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11437
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003247 Nonsense 137 536 5 17
ENSDART00000041402 Nonsense 137 536 5 17
Genomic Location (Zv9):
Chromosome 4 (position 24568449)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25492118
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTWATTTTTTCCACAGGTTTTTGATGCAACAAACACAACCAGAGATCGA[C/T]GAGATWTGATCTTGGAGTTTGGTGCAGAAAATGGCTTCAAGGTTGGTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link