b3gat3

Ensembl ID:
ENSDARG00000001939
ZFIN ID:
ZDB-GENE-020419-3
Description:
beta-1,3-glucuronyltransferase 3 [Source:RefSeq peptide;Acc:NP_001015059]
Human Orthologue:
B3GAT3
Human Description:
beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) [Source:HGNC Symbol;Acc:923]
Mouse Orthologue:
B3gat3
Mouse Description:
beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) Gene [Source:MGI Symbol;Acc:MGI:1919977

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17161 Essential Splice Site, Missense Available for shipment Available now

Mutation Details

Allele Name:
sa17161
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025582 None None 326 None 7
ENSDART00000109696 Missense 328 328 5 5
ENSDART00000122164 Essential Splice Site 329 368 5 6
Genomic Location:
Chromosome 7 (position 26193948)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAAGAAGCTTTGCTGAAGCAGGGGATGGGCTCTGATCCGGATGTGGAG[G/A]TGTGAGCAGAACRTGYCCGAACTTCACCAAACATCCACACTTCCATTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7bdvh7lo