LOC100334818

Ensembl ID:
ENSDARG00000001937
Human Orthologues:
SLC2A1, SLC2A14, SLC2A2, SLC2A3, SLC2A4
Human Descriptions:
solute carrier family 2 (facilitated glucose transporter), member 1 [Source:HGNC Symbol;Acc:11005]
solute carrier family 2 (facilitated glucose transporter), member 14 [Source:HGNC Symbol;Acc:18301]
solute carrier family 2 (facilitated glucose transporter), member 2 [Source:HGNC Symbol;Acc:11006]
solute carrier family 2 (facilitated glucose transporter), member 3 [Source:HGNC Symbol;Acc:11007]
solute carrier family 2 (facilitated glucose transporter), member 4 [Source:HGNC Symbol;Acc:11009]
Mouse Orthologues:
Slc2a1, Slc2a2, Slc2a3, Slc2a4
Mouse Descriptions:
solute carrier family 2 (facilitated glucose transporter), member 1 Gene [Source:MGI Symbol;Acc:MGI:
solute carrier family 2 (facilitated glucose transporter), member 2 Gene [Source:MGI Symbol;Acc:MGI:
solute carrier family 2 (facilitated glucose transporter), member 3 Gene [Source:MGI Symbol;Acc:MGI:
solute carrier family 2 (facilitated glucose transporter), member 4 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43001 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43001
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019804 Nonsense 48 482 2 9
Genomic Location (Zv9):
Chromosome 17 (position 48597955)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 48360302
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGACATTTTAAATTAAGGTGATTGAAGAGTTTTTCAACACGACATGG[A/T]GATCCAGACACAATCAGTCAATTCCAGACCACAGTCTGACGTTCCTGTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link