si:ch211-153l6.5

Ensembl ID:
ENSDARG00000001913
ZFIN ID:
ZDB-GENE-070705-48
Description:
LOC559824 protein [Source:UniProtKB/TrEMBL;Acc:Q1RLW3]
Human Orthologue:
PALMD
Human Description:
palmdelphin [Source:HGNC Symbol;Acc:15846]
Mouse Orthologue:
Palmd
Mouse Description:
palmdelphin Gene [Source:MGI Symbol;Acc:MGI:2148896]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15796 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15796
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006817 Nonsense 240 462 7 7
ENSDART00000137848 Nonsense 237 459 8 8
Genomic Location (Zv9):
Chromosome 2 (position 18932119)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20760850
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCACCAGCCTGGAGCCAACGGAGTGGATGAACTYAGTCCTGTGGAGGTC[G/T]AAGAGCTGCTCAGACAGGCCTCAGGAAAGAAGAAATTGGGCAATCAAGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link