rorab

Ensembl ID:
ENSDARG00000001910
ZFIN ID:
ZDB-GENE-040426-855
Description:
RAR-related orphan receptor A, paralog b [Source:RefSeq peptide;Acc:NP_957361]
Human Orthologue:
RORA
Human Description:
RAR-related orphan receptor A [Source:HGNC Symbol;Acc:10258]
Mouse Orthologue:
Rora
Mouse Description:
RAR-related orphan receptor alpha Gene [Source:MGI Symbol;Acc:MGI:104661]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34088 Nonsense Available for shipment Available now
sa20963 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34088
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019140 Nonsense 51 474 3 10
ENSDART00000099477 Nonsense 51 492 3 11
ENSDART00000125544 Nonsense 50 491 3 11
Genomic Location (Zv9):
Chromosome 7 (position 30893185)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29285527
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTCTGTCAGGGTTTCTTCAGGAGGAGTCAGCAGGGCACTGTGTCATA[T/G]TCATGTCCTCGGCAGAAGAGCTGTCTGATCGACCGTACCAGCAGAAACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20963
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019140 Nonsense 110 474 4 10
ENSDART00000099477 Nonsense 110 492 4 11
ENSDART00000125544 Nonsense 109 491 4 11
Genomic Location (Zv9):
Chromosome 7 (position 30889947)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29282289
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAGAAGCAGAGGGACAGTCTGTTCGCAGAGGTTCAGAAGCACCGTCAG[C/T]AGCAGCAGGATGACAAAACCGGTGACGAGTCTGAGAAGAATCAGGAAAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link