LOC555361

Ensembl ID:
ENSDARG00000001909
Human Orthologue:
VILL
Human Description:
villin-like [Source:HGNC Symbol;Acc:30906]
Mouse Orthologue:
Vill
Mouse Description:
villin-like Gene [Source:MGI Symbol;Acc:MGI:1201781]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14098 Nonsense Available for shipment Available now
sa12859 Nonsense Available for shipment Available now
sa9242 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24481 Nonsense Mutation detected in F1 DNA During 2014
sa14066 Nonsense Available for shipment Available now
sa8412 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14098
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048940 Nonsense 182 850 5 19
Genomic Location:
Chromosome 24 (position 21045093)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TRGACTTGGGAAAWGCTATAAYACAATGGAATGGTCCTCAAAGCAACAGA[C/T]AAGAGAAGTTAAAGGTAATTAWAGAAATCGTYAACYTAAATAYGAAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12859
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048940 Nonsense 266 850 7 19
Genomic Location:
Chromosome 24 (position 21041124)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WGCTTGGGTTTTTTCACAGGGTGTCAGAYGCCAGTGGTCAGCTGYTGGTA[C/T]AGGAAGTGGCTGTCAGTCCACTCACCCAGGATCTGCTGTGCTCCTCTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9242
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048940 Essential Splice Site 365 850 9 19
Genomic Location:
Chromosome 24 (position 21040632)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGGTCAAACYCAAGGCCTGGGAAAGACACACTCAGYAGGAAAGATAG[G/A]TGAYTGGTCATTCAGTGTTATTTCTCATTATGTTTCASTAGTGGGTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24481
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048940 Nonsense 431 850 11 19
Genomic Location:
Chromosome 24 (position 21040282)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTATGGACAGTTTTATGGAGGAGACTGTTATCTAGTTTTGTACACCTA[C/A]AACAGAGCCAACAAACCTCAGTATATCCTCTACATCTGGCAGGTGAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14066
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048940 Nonsense 723 850 17 19
Genomic Location:
Chromosome 24 (position 21029826)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACTTTYTGAGTTTGACTTTACGTRTATATTCCAGGGAGGCCTTTCATA[T/A]GAAGAGATGAAAAGCAAGCTGGGTGATGTTTCACAAATCACTGTGDTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8412
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048940 Essential Splice Site 738 850 17 19
ENSDART00000048940 Essential Splice Site 738 850 17 19
Genomic Location:
Chromosome 24 (position 21029780)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATATGAAGAGATGAAAAGCAAGCTGGGTGATGTTTCACAAATCACTGTG[G/A]TAAAATYATTYACCATACCAATCAAATGCTTGTTCCTGCATGCATTAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cp1lpcm8