LOC555361

Ensembl ID:
ENSDARG00000001909
Human Orthologue:
VILL
Human Description:
villin-like [Source:HGNC Symbol;Acc:30906]
Mouse Orthologue:
Vill
Mouse Description:
villin-like Gene [Source:MGI Symbol;Acc:MGI:1201781]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32486 Nonsense Mutation detected in F1 DNA During 2016
sa14098 Nonsense Available for shipment Available now
sa12859 Nonsense Available for shipment Available now
sa9242 Essential Splice Site Mutation detected in F1 DNA During 2016
sa24481 Nonsense Mutation detected in F1 DNA During 2016
sa39445 Nonsense Mutation detected in F1 DNA During 2016
sa14066 Nonsense Available for shipment Available now
sa8412 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32486
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048940 Nonsense 173 850 5 19
Genomic Location (Zv9):
Chromosome 24 (position 21045120)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20292249
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTAATCTAGGGGACGTTTTCCTGCTAGACTTGGGAAAAGCTATAATA[C/T]AATGGAATGGTCCTCAAAGCAACAGACAAGAGAAGTTAAAGGTAATTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14098
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048940 Nonsense 182 850 5 19
Genomic Location (Zv9):
Chromosome 24 (position 21045093)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20292222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TRGACTTGGGAAAWGCTATAAYACAATGGAATGGTCCTCAAAGCAACAGA[C/T]AAGAGAAGTTAAAGGTAATTAWAGAAATCGTYAACYTAAATAYGAAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12859
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048940 Nonsense 266 850 7 19
Genomic Location (Zv9):
Chromosome 24 (position 21041124)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20288253
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WGCTTGGGTTTTTTCACAGGGTGTCAGAYGCCAGTGGTCAGCTGYTGGTA[C/T]AGGAAGTGGCTGTCAGTCCACTCACCCAGGATCTGCTGTGCTCCTCTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9242
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048940 Essential Splice Site 365 850 9 19
Genomic Location (Zv9):
Chromosome 24 (position 21040632)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20287761
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGGTCAAACYCAAGGCCTGGGAAAGACACACTCAGYAGGAAAGATAG[G/A]TGAYTGGTCATTCAGTGTTATTTCTCATTATGTTTCASTAGTGGGTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24481
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048940 Nonsense 431 850 11 19
Genomic Location (Zv9):
Chromosome 24 (position 21040282)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20287411
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTATGGACAGTTTTATGGAGGAGACTGTTATCTAGTTTTGTACACCTA[C/A]AACAGAGCCAACAAACCTCAGTATATCCTCTACATCTGGCAGGTGAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39445
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048940 Nonsense 653 850 15 19
Genomic Location (Zv9):
Chromosome 24 (position 21033569)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20280698
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTACTCAGGATGACCTGGATGAGGACGACGTCATGCTGCTCGACACCT[G/A]GGATGAGGTGTGTTTCAGCAGATTAGCACTGTTTGAATGCGGCTGTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14066
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048940 Nonsense 723 850 17 19
Genomic Location (Zv9):
Chromosome 24 (position 21029826)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20276955
KASP Assay ID:
2261-8648.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACTTTYTGAGTTTGACTTTACGTRTATATTCCAGGGAGGCCTTTCATA[T/A]GAAGAGATGAAAAGCAAGCTGGGTGATGTTTCACAAATCACTGTGDTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8412
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048940 Essential Splice Site 738 850 17 19
ENSDART00000048940 Essential Splice Site 738 850 17 19
Genomic Location (Zv9):
Chromosome 24 (position 21029780)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20276909
KASP Assay ID:
554-4961.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATATGAAGAGATGAAAAGCAAGCTGGGTGATGTTTCACAAATCACTGTG[G/A]TAAAATYATTYACCATACCAATCAAATGCTTGTTCCTGCATGCATTAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link